How can I force a long string without any blank to be wrapped?

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

16 Answers
16

Leave a Comment