• Home
  • About
    • IT Nursery
    • Price Plan Style
    • Testimonials Style
    • FAQ’s
  • Portfolio Filter
  • Services
    • All Services
    • Business Consulting
    • Finance Report
    • Assets Mangement
    • Smart Manufacturing
    • Life Insurance
    • Tax & Order Making
  • News
  • Contact
IT Nursery

Expert WordPress Theme Developer. Can developing websites by using Elementor, divi and Visual Composer. Provide 100% guarantee on the quality and reliability of the code.

  • (+880) 1676299226
  • info@itnursery.com
  • Office Hour: 8AM - 11PM
    • About
    • About Us
    • Assets Mangement
    • Business Consulting
    • Call To Action Style
    • Contact
    • Counter Style
    • FAQ’s
    • Finance Report
    • Heading Style
    • Home
    • Home Five
    • Home Four
    • Home Seven
    • Home Six
    • Home Three
    • Home Two
    • Life Insurance
    • News
    • Portfolio Filter
    • Portfolio Grid Style
    • Portfolio Grid Style 1
    • Portfolio Grid Style 2
    • Portfolio Slider Style
    • Price Plan Style
    • Privacy Policy
    • Sample Page
    • Services
    • Services Style
    • Smart Manufacturing
    • Tax & Order Making
    • Team Filter Style
    • Team Grid Style
    • Testimonials Style
  • info@itnursery.com
  • (880) 1911-024205
IT Nursery
IT Nursery
  • 1010 Avenue of the Moon
    New York, NY 10018 US.
  • Mon - Sat 8.00 - 18.00
    Sunday: Closed
  • Get A Quote
IT Nursery
  • Home
  • About
    • IT Nursery
    • Price Plan Style
    • Testimonials Style
    • FAQ’s
  • Portfolio Filter
  • Services
    • All Services
    • Business Consulting
    • Finance Report
    • Assets Mangement
    • Smart Manufacturing
    • Life Insurance
    • Tax & Order Making
  • News
  • Contact
IT Nursery > News > word-wrap

word-wrap

Programming, wpf
IT Nursery

WPF text Wrap vs WrapWithOverflow

What’s the “conceptual” difference between TextWrapping="Wrap" and TextWrapping="WrapWithOverflow" (e.g. for a TextBox)? In the MSDN page about the class TextBox there is nothing ...
  • June 4, 2022
  • 0 Comments
HTML, Programming
IT Nursery

How to word wrap text in HTML?

How can text like aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa which exceeds the width of a div (say 200px) be wrapped? I am open to any kind of ...
  • May 31, 2022
  • 0 Comments
HTML, Programming
IT Nursery

How to make a DIV not wrap?

I need to create a container DIV style that contains multiple other DIV’s. It is asked that these DIV’s wouldn’t wrap if the ...
  • May 31, 2022
  • 0 Comments
HTML, Programming
IT Nursery

How can I force a long string without any blank to be wrapped?

I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS ...
  • May 28, 2022
  • 0 Comments

How to wrap text of HTML button with fixed width?

I just noticed that if you give an HTML button a fixed width, the text inside the button is never wrapped. I’ve tried ...
  • May 24, 2022
  • 0 Comments

How should I use git diff for long lines?

I’m running git-diff on a file, but the change is at the end of a long line. If I use cursor keys to ...
  • May 22, 2022
  • 0 Comments

vim command to restructure/force text to 80 columns

I know there are ways to automatically set the width of text in vim using set textwidth (like Vim 80 column layout concerns). ...
  • May 19, 2022
  • 0 Comments

How can I wrap text in a label using WPF?

I have a TextBox and a Label. After clicking a button, I execute the following code: label1.Content = textbox1.Text; My question is, how ...
  • May 18, 2022
  • 0 Comments

How can I toggle word wrap in Visual Studio?

Does Visual Studio .NET have a way to toggle word-wrap on and off? I am used to this feature in Eclipse which allows ...
  • May 10, 2022
  • 0 Comments

How to stop text from taking up more than 1 line?

Is there a word-wrap or any other attribute that stops text from wrapping? I have a height, and overflow:hidden, and the text still ...
  • May 8, 2022
  • 0 Comments

Posts pagination

1 2 Next

Recent Posts

  • INSTALL_FAILED_DUPLICATE_PERMISSION… C2D_MESSAGE
  • How to sort by meta value?
  • WPF text Wrap vs WrapWithOverflow
  • How to retrieve the list of all posts ever published via the feed?
  • how to use javascript Object.defineProperty

android c categories CSS custom-post-types custom-taxonomy customization database functions git HTML images java javascript jQuery multisite MySQL php plugin-development plugins posts python string theme-development wp-query

Important Tag

.net admin ajax android arrays bash c categories comments CSS custom-field custom-post-types custom-taxonomy customization database filters functions git hooks HTML images ios java javascript jQuery menus multisite MySQL node.js permalinks php plugin-development plugins posts python Shortcode sql string theme-development themes uploads users woocommerce-offtopic wp-admin wp-query

Search Here

Popular News

INSTALL_FAILED_DUPLICATE_PERMISSION… C2D_MESSAGE June 4, 2022
How to sort by meta value? June 4, 2022
WPF text Wrap vs WrapWithOverflow June 4, 2022
How to retrieve the list of all posts ever published via the feed? June 4, 2022
how to use javascript Object.defineProperty June 4, 2022

Categories

  • .htaccess (5)
  • .net (145)
  • .net-4.0 (2)
  • .net-core (2)
  • .net-core-configuration (1)
  • 64-bit (1)
  • abi (1)
  • access-modifiers (1)
  • accessibility (1)
  • actionscript-3 (1)
  • active-directory (2)
  • adsense (1)
  • agile (1)
  • ajax (22)
  • algorithm (88)
  • amazon-ec2 (4)
  • amazon-web-services (39)
  • anaconda (2)
  • android (1,061)
  • android-dialogfragment (1)
  • android-emulator (3)
  • android-studio (35)
  • android-xml (1)
  • angular (139)
  • angular-cli (3)
  • angular6 (1)
  • angularjs (109)
  • angularjs-timeout (1)
  • animation (1)
  • ansible (7)
  • ant (1)
  • aop (1)
  • apache (19)
  • apache-flex (1)
  • apache-kafka (4)
  • apache-spark (6)
  • apache-zookeeper (1)
  • api (1)
  • apple-touch-icon (1)
  • architecture (13)
  • archive (1)
  • arrays (49)
  • artificial-intelligence (2)
  • asp-classic (1)
  • ASP.NET (77)
  • asp.net-core (3)
  • asp.net-mvc (60)
  • asp.net-mvc-2 (1)
  • asp.net-mvc-3 (6)
  • asp.net-mvc-4 (2)
  • asp.net-web-api (3)
  • assembly (6)
  • asynchronous (3)
  • atom-editor (1)
  • audio (2)
  • authentication (15)
  • autocomplete (2)
  • avd (1)
  • avmutableaudiomixinputparameters (1)
  • awk (4)
  • axios (2)
  • azure (3)
  • azure-web-roles (1)
  • backup (1)
  • base64 (2)
  • bash (358)
  • basic-authentication (1)
  • batch-file (23)
  • benchmarking (1)
  • big-o (1)
  • binary (2)
  • binary-tree (1)
  • bitbucket (1)
  • bluetooth (1)
  • bootstrap-4 (2)
  • bootstrapping (1)
  • bower (1)
  • branch (1)
  • branch-prediction (1)
  • Browser (7)
  • buffer (1)
  • build (3)
  • Business (3)
  • button (1)
  • C (219)
  • C# (1,430)
  • c#-4.0 (1)
  • C++ (676)
  • c++11 (2)
  • caching (3)
  • callback (1)
  • callstack (1)
  • captcha (1)
  • cassandra (1)
  • casting (1)
  • centos (2)
  • certificate (3)
  • cgi (1)
  • character-encoding (3)
  • chart.js (1)
  • checkbox (1)
  • class (4)
  • classpath (1)
  • client-server (1)
  • clojure (1)
  • cloud (1)
  • cmake (8)
  • cmd (1)
  • cocoa (8)
  • cocoa-touch (2)
  • cocoapods (1)
  • code-formatting (2)
  • coding-style (2)
  • collections (3)
  • colors (4)
  • comet (1)
  • command (1)
  • command-line (14)
  • comments (4)
  • common-lisp (1)
  • compare (1)
  • compilation (1)
  • compilationunit (1)
  • compiler-construction (4)
  • compiler-theory (1)
  • composer-php (2)
  • compression (3)
  • computer-science (2)
  • concurrency (4)
  • conditional-operator (1)
  • configuration (6)
  • confluence (1)
  • constants (1)
  • Consulting (1)
  • content-security-policy (1)
  • continuous-integration (2)
  • cookies (5)
  • copy (1)
  • cordova (4)
  • cors (2)
  • cpu (1)
  • cpu-architecture (1)
  • cqrs (1)
  • cron (2)
  • crontab (1)
  • cross-browser (1)
  • cryptography (1)
  • csrf (1)
  • CSS (382)
  • css-float (1)
  • css-selectors (2)
  • csv (5)
  • cuda (7)
  • curl (14)
  • custom-installation (1)
  • cx-oracle (1)
  • cygwin (2)
  • dapper (1)
  • dart (9)
  • data-oriented-design (1)
  • data-structures (4)
  • Database (63)
  • database-design (4)
  • dataframe (1)
  • datatable (1)
  • date (5)
  • datetime (9)
  • debian (2)
  • debugging (14)
  • default (1)
  • dependency-injection (4)
  • deployment (2)
  • design-patterns (26)
  • dictionary (10)
  • didselectrowatindexpath (1)
  • digital-signature (1)
  • directory (1)
  • django (62)
  • dll (2)
  • dns (4)
  • docker (160)
  • docker-compose (2)
  • dockerfile (1)
  • documentation (1)
  • domain-driven-design (3)
  • dos (1)
  • download (3)
  • duplicates (1)
  • dynamic-programming (2)
  • eclipse (66)
  • ecmascript-6 (1)
  • editor (5)
  • elasticsearch (10)
  • elisp (1)
  • elixir (1)
  • emacs (9)
  • email (8)
  • embedded-fonts (1)
  • ember.js (1)
  • emulation (1)
  • encoding (4)
  • encryption (4)
  • entity-framework (12)
  • entity-framework-4 (1)
  • entity-framework-core (1)
  • enums (2)
  • environment-variables (1)
  • erlang (2)
  • error-handling (1)
  • escaping (1)
  • eslint (2)
  • events (1)
  • excel (22)
  • excel-2007 (1)
  • exception (6)
  • exception-handling (1)
  • express (2)
  • facebook (9)
  • factory-pattern (1)
  • favicon (5)
  • ffmpeg (7)
  • fiddler (1)
  • file (20)
  • file-extension (1)
  • file-io (2)
  • filesystems (1)
  • Finance (1)
  • find (1)
  • firebase (7)
  • fish (1)
  • fixtures (1)
  • flash (2)
  • flexbox (1)
  • floating-point (4)
  • flutter (47)
  • font-size (1)
  • fonts (7)
  • for-loop (3)
  • foreach (1)
  • form-submit (1)
  • formatting (4)
  • forms (11)
  • frameworks (3)
  • function (10)
  • functional-programming (10)
  • g++ (1)
  • garbage-collection (1)
  • gcc (12)
  • gdata (1)
  • gdb (6)
  • gem (1)
  • generics (2)
  • geolocation (1)
  • geometry (2)
  • git (1,216)
  • git-bash (1)
  • git-branch (1)
  • git-commit (1)
  • git-merge (1)
  • github (57)
  • github-actions (1)
  • gitlab (4)
  • gnuplot (1)
  • go (47)
  • Google (6)
  • google-analytics (5)
  • google-api (3)
  • google-app-engine (2)
  • google-chrome (46)
  • google-chrome-devtools (1)
  • google-cloud-platform (2)
  • google-drive-api (1)
  • google-maps (5)
  • google-maps-api-3 (1)
  • google-play-services (1)
  • google-search (1)
  • google-sheets (5)
  • google-voice (1)
  • gradle (9)
  • graphics (2)
  • graphviz (1)
  • grep (7)
  • groovy (5)
  • gruntjs (1)
  • guid (2)
  • gulp (2)
  • gunicorn (1)
  • gzip (1)
  • hadoop (3)
  • handlebars.js (2)
  • hash (5)
  • haskell (28)
  • heroku (5)
  • hibernate (3)
  • homebrew (8)
  • hook (1)
  • HTML (22)
  • HTML (600)
  • html-lists (1)
  • html5-video (1)
  • http (75)
  • http-headers (7)
  • http-post (1)
  • https (3)
  • hungarian-notation (1)
  • icons (3)
  • ide (5)
  • if-statement (4)
  • iframe (2)
  • iis (5)
  • iis-7 (1)
  • iis-express (1)
  • image (16)
  • image-processing (4)
  • imagemagick (1)
  • imagenet (1)
  • import (3)
  • indentation (1)
  • indexing (1)
  • inheritance (3)
  • innovation (1)
  • installation (3)
  • integer (2)
  • intellij-idea (30)
  • intellisense (1)
  • internet-explorer (6)
  • internet-explorer-8 (1)
  • internet-explorer-9 (1)
  • ionic-framework (1)
  • ios (515)
  • ios7 (1)
  • ios8 (1)
  • ip (2)
  • iphone (54)
  • ipython (4)
  • iterm (2)
  • jackson (1)
  • jakarta-ee (1)
  • Java (3,354)
  • Java Script (3)
  • javafx (1)
  • javascript (2,578)
  • jenkins (11)
  • jestjs (5)
  • jinja2 (2)
  • jira (1)
  • jms (2)
  • jndi (1)
  • jpa (1)
  • jquery (279)
  • jquery-plugins (1)
  • jquery-ui (1)
  • jquery-validate (1)
  • jsf (6)
  • jshint (1)
  • json (80)
  • jsp (5)
  • junit (1)
  • jupyter-notebook (1)
  • jwt (1)
  • keyboard (2)
  • keyboard-shortcuts (4)
  • keystore (2)
  • keytool (1)
  • kotlin (15)
  • kubernetes (13)
  • lambda (1)
  • language-agnostic (36)
  • laravel (21)
  • latex (8)
  • layout (2)
  • licensing (1)
  • line-breaks (1)
  • linq (9)
  • linq-to-sql (3)
  • lint (1)
  • linux (338)
  • lisp (1)
  • list (6)
  • listview (1)
  • localhost (3)
  • localization (1)
  • log4j (1)
  • log4net (1)
  • logging (9)
  • logic (1)
  • loops (3)
  • lua (1)
  • lvm (1)
  • machine-learning (10)
  • macos (90)
  • macros (1)
  • magic-numbers (1)
  • makefile (21)
  • malloc (1)
  • mapreduce (1)
  • markdown (17)
  • math (11)
  • matlab (5)
  • matplotlib (3)
  • maven (24)
  • maven-2 (9)
  • memory (2)
  • memory-management (2)
  • mercurial (9)
  • merge (1)
  • methodology (1)
  • mime-types (2)
  • mocha.js (1)
  • model-view-controller (2)
  • momentjs (1)
  • mongodb (66)
  • mousewheel (1)
  • ms-word (1)
  • msbuild (2)
  • multipartform-data (1)
  • multithreading (19)
  • mvvm (1)
  • MySQL (378)
  • mysqldump (1)
  • naming-conventions (2)
  • networking (11)
  • neural-network (1)
  • newline (2)
  • nginx (14)
  • nhibernate (1)
  • node-webkit (1)
  • node.js (292)
  • nosql (3)
  • notepad++ (9)
  • npm (15)
  • nsstring (2)
  • nuget (5)
  • nullable (1)
  • numbers (1)
  • oauth (6)
  • oauth-2.0 (1)
  • objective-c (104)
  • odbc (1)
  • oop (28)
  • open-source (1)
  • opengl (3)
  • openssl (5)
  • operating-system (2)
  • operators (1)
  • optimization (4)
  • oracle (12)
  • orm (1)
  • out-of-memory (1)
  • outlook (1)
  • overflow (2)
  • package (1)
  • pandas (2)
  • parallel-processing (1)
  • parameters (3)
  • parsing (1)
  • path (5)
  • pdf (6)
  • perforce (1)
  • performance (25)
  • perl (13)
  • permissions (2)
  • PHP (584)
  • phpmyadmin (1)
  • pip (1)
  • pipenv (1)
  • playframework (1)
  • plot (1)
  • png (1)
  • podcast (1)
  • pointers (2)
  • port (1)
  • post (5)
  • postgresql (86)
  • powershell (51)
  • process (1)
  • Programming (21,581)
  • programming-languages (10)
  • properties (2)
  • protocol-buffers (2)
  • proxy (2)
  • pthreads (1)
  • pycharm (1)
  • Python (2,549)
  • python-3.x (1)
  • qt (2)
  • r (169)
  • rabbitmq (2)
  • random (4)
  • razor (1)
  • rdf (1)
  • react-native (7)
  • react-router-v4 (1)
  • reactjs (84)
  • realm (1)
  • recursion (2)
  • redirect (3)
  • redis (14)
  • reference (1)
  • regex (100)
  • replace (2)
  • request (1)
  • require (1)
  • requirejs (1)
  • requirements (1)
  • resources (2)
  • rest (34)
  • rsync (3)
  • ruby (182)
  • ruby-on-rails (181)
  • ruby-on-rails-3 (6)
  • ruby-on-rails-3.1 (1)
  • rubygems (1)
  • rust (13)
  • rxjs (2)
  • sass (3)
  • sbt (1)
  • scala (49)
  • scheduled-tasks (1)
  • scheme (1)
  • scope (1)
  • scripting (7)
  • scroll (2)
  • sdk (1)
  • search (7)
  • security (32)
  • sed (5)
  • select (1)
  • selenium (5)
  • selenium-webdriver (1)
  • seo (2)
  • serialization (2)
  • server (1)
  • server-side (1)
  • service (1)
  • servicestack (1)
  • servlets (1)
  • session (4)
  • sftp (1)
  • sh (2)
  • share (1)
  • shell (50)
  • signals (1)
  • soa (1)
  • sockets (6)
  • software-distribution (1)
  • solr (1)
  • sonarqube (1)
  • sorting (1)
  • special-characters (1)
  • spring (22)
  • spring-boot (1)
  • spring-mvc (1)
  • sql (446)
  • sql-server (157)
  • sql-server-2005 (2)
  • sql-server-2008 (5)
  • sql-server-2012 (1)
  • sqlite (21)
  • ssh (20)
  • ssh-keys (1)
  • ssl (8)
  • ssms (2)
  • stack-trace (1)
  • statistics (1)
  • string (61)
  • string-formatting (1)
  • struct (1)
  • subdomain (1)
  • sublimetext (5)
  • sublimetext2 (10)
  • sublimetext3 (1)
  • svg (7)
  • svn (42)
  • swift (74)
  • swift2 (1)
  • swiftui (1)
  • swing (3)
  • symfony (6)
  • synchronization (1)
  • syntax (6)
  • syntax-highlighting (1)
  • tabs (3)
  • task (1)
  • tcp (3)
  • telegram (1)
  • tensorflow (6)
  • terminal (6)
  • terminology (9)
  • testing (8)
  • text (6)
  • text-files (1)
  • text-processing (1)
  • tfs (4)
  • themes (3)
  • theory (2)
  • time (1)
  • time-complexity (1)
  • timezone (1)
  • tmux (5)
  • tomcat8 (1)
  • travis-ci (2)
  • tsql (6)
  • turtle-graphics (1)
  • Tutorial (18)
  • twig (1)
  • twitter (1)
  • twitter-bootstrap (21)
  • twitter-bootstrap-3 (2)
  • type-safety (1)
  • types (4)
  • typescript (97)
  • ubuntu (21)
  • ubuntu-16.04 (1)
  • uiimage (1)
  • uikit (1)
  • uitableview (1)
  • uiview (1)
  • uml (3)
  • Uncategorized (11)
  • underscore.js (1)
  • undo (1)
  • unicode (10)
  • unit-testing (26)
  • unix (40)
  • upload (1)
  • url (11)
  • urlencode (1)
  • urllib (1)
  • user-agent (1)
  • user-interface (6)
  • utf-8 (1)
  • uuid (1)
  • vagrant (4)
  • validation (9)
  • variables (3)
  • vb.net (3)
  • vb6 (1)
  • vba (4)
  • vectorization (1)
  • version-control (11)
  • versioning (1)
  • vi (1)
  • video (6)
  • view (1)
  • vim (116)
  • virtual-machine (1)
  • virtualbox (3)
  • visual-c++ (3)
  • visual-studio (89)
  • visual-studio-2008 (1)
  • visual-studio-2010 (14)
  • visual-studio-2012 (4)
  • visual-studio-2013 (5)
  • visual-studio-2015 (4)
  • visual-studio-code (72)
  • vue.js (15)
  • wamp (1)
  • warnings (1)
  • wcf (8)
  • wcf-binding (1)
  • Web Programming (11)
  • web-applications (2)
  • web-services (13)
  • webpack (5)
  • webserver (1)
  • webservice-client (1)
  • websocket (2)
  • webstorm (1)
  • wget (2)
  • winapi (1)
  • window (1)
  • windows (168)
  • windows-7 (3)
  • windows-8 (1)
  • windows-server-2003 (1)
  • windows-server-2008 (1)
  • windows-services (5)
  • windows-vista (1)
  • wireshark (1)
  • wix (1)
  • WordPress (22,083)
  • wpf (31)
  • x509 (1)
  • x86 (2)
  • xaml (2)
  • xargs (1)
  • xcode (62)
  • xcode4 (1)
  • xml (37)
  • xml-parsing (1)
  • xna (1)
  • xpath (3)
  • xslt (4)
  • yaml (5)
  • yarnpkg (2)
  • youtube (1)
  • zsh (2)

Tags

.net admin ajax android arrays bash c categories comments CSS custom-field custom-post-types custom-taxonomy customization database filters functions git hooks HTML images ios java javascript jQuery menus multisite MySQL node.js permalinks php plugin-development plugins posts python Shortcode sql string theme-development themes uploads users woocommerce-offtopic wp-admin wp-query
IT Nursery

About IT Nursery

Expert WordPress Theme Developer. Can developing websites by using Elementor, divi and Visual Composer. Provide 100% guarantee on the quality and reliability of the code.

Our Services

  • Business Consulting
  • Finance Report
  • Life Insurance
  • Tax & Order Making
  • Assets Mangement

Get In Touch

  • (+880) 1911-024205
  • info@itnursery.com
  • Office Hour: 8AM - 11PM

Subscribe Now

    IT Nursery - 2025