WPF text Wrap vs WrapWithOverflow
What’s the “conceptual” difference between TextWrapping=”Wrap” and TextWrapping=”WrapWithOverflow” (e.g. for a TextBox)? In the MSDN page about the class TextBox there is nothing … Thank you. 3 Answers 3
What’s the “conceptual” difference between TextWrapping=”Wrap” and TextWrapping=”WrapWithOverflow” (e.g. for a TextBox)? In the MSDN page about the class TextBox there is nothing … Thank you. 3 Answers 3
How can text like aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa which exceeds the width of a div (say 200px) be wrapped? I am open to any kind of solution such as CSS, jQuery, etc. 19 Answers 19
I need to create a container DIV style that contains multiple other DIV’s. It is asked that these DIV’s wouldn’t wrap if the browser window is resized to be narrow. I tried to make it work like below. <style> .container { min-width: 3000px; overflow: hidden; } .slide { float: left; } </style> <div class=”container”> <div … Read more
I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox? 16 Answers 16
I just noticed that if you give an HTML button a fixed width, the text inside the button is never wrapped. I’ve tried it with word-wrap, but that cuts of the word even though there are spaces available to wrap on. How can I make the text of an HTML button with a fixed width … Read more
I’m running git-diff on a file, but the change is at the end of a long line. If I use cursor keys to move right, it loses colour-coding—and worse the lines don’t line up—making it harder to track the change. Is there a way to prevent that problem or to simply make the lines wrap … Read more
I know there are ways to automatically set the width of text in vim using set textwidth (like Vim 80 column layout concerns). What I am looking for is something similar to = (the indent line command) but to wrap to 80. The use case is sometimes you edit text with textwidth and after joining … Read more
I have a TextBox and a Label. After clicking a button, I execute the following code: label1.Content = textbox1.Text; My question is, how do I enable text wrapping of the label? There may be too much text to display on one line, and I want it to automatically wrap to multiple lines if that is … Read more
Does Visual Studio .NET have a way to toggle word-wrap on and off? I am used to this feature in Eclipse which allows you to right click and toggle word wrap on and off so that when you have long lines that extend out to the right, you don’t have to move the bottom scroll … Read more
Is there a word-wrap or any other attribute that stops text from wrapping? I have a height, and overflow:hidden, and the text still breaks. Needs to work in all browsers, before CSS3. 5 Answers 5