Skip to content
IT Nursery
  • Home
  • Programming
    • PHP
    • C
    • C++
  • DataBase
    • MySQL
  • CMS
    • WordPress

word-wrap

WPF text Wrap vs WrapWithOverflow

by IT Nursery

What’s the “conceptual” difference between TextWrapping=”Wrap” and TextWrapping=”WrapWithOverflow” (e.g. for a TextBox)? In the MSDN page about the class TextBox there is nothing … Read more

Tags word-wrap, wpf

How to word wrap text in HTML?

by IT Nursery

How can text like aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa which exceeds the width of a div (say 200px) be wrapped? I am open to any kind of … Read more

Tags CSS, HTML, word-wrap

How to make a DIV not wrap?

by IT Nursery

I need to create a container DIV style that contains multiple other DIV’s. It is asked that these DIV’s wouldn’t wrap if the … Read more

Tags CSS, HTML, nowrap, word-wrap

How can I force a long string without any blank to be wrapped?

by IT Nursery

I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS … Read more

Tags CSS, HTML, string, word-wrap, xul

How to wrap text of HTML button with fixed width?

by IT Nursery

I just noticed that if you give an HTML button a fixed width, the text inside the button is never wrapped. I’ve tried … Read more

Tags button, CSS, HTML, word-wrap

How should I use git diff for long lines?

by IT Nursery

I’m running git-diff on a file, but the change is at the end of a long line. If I use cursor keys to … Read more

Tags diff, git, word-wrap

vim command to restructure/force text to 80 columns

by IT Nursery

I know there are ways to automatically set the width of text in vim using set textwidth (like Vim 80 column layout concerns). … Read more

Tags vim, word-wrap

How can I wrap text in a label using WPF?

by IT Nursery

I have a TextBox and a Label. After clicking a button, I execute the following code: label1.Content = textbox1.Text; My question is, how … Read more

Tags .net, c, label, word-wrap, wpf

How can I toggle word wrap in Visual Studio?

by IT Nursery

Does Visual Studio .NET have a way to toggle word-wrap on and off? I am used to this feature in Eclipse which allows … Read more

Tags visual-studio, word-wrap

How to stop text from taking up more than 1 line?

by IT Nursery

Is there a word-wrap or any other attribute that stops text from wrapping? I have a height, and overflow:hidden, and the text still … Read more

Tags CSS, HTML, text, word-wrap
Post navigation
Older posts
Page1 Page2 Next →

Important Tag

.net admin ajax android arrays bash c categories comments CSS custom-field custom-post-types custom-taxonomy customization database filters functions git hooks HTML images ios java javascript jQuery menus multisite MySQL node.js permalinks php plugin-development plugins posts python Shortcode sql string theme-development themes uploads users woocommerce-offtopic wp-admin wp-query

Recent Posts

  • INSTALL_FAILED_DUPLICATE_PERMISSION… C2D_MESSAGE
  • How to sort by meta value?
  • WPF text Wrap vs WrapWithOverflow
  • How to retrieve the list of all posts ever published via the feed?
  • how to use javascript Object.defineProperty

android c categories CSS custom-post-types custom-taxonomy customization database functions git HTML images java javascript jQuery multisite MySQL php plugin-development plugins posts python string theme-development wp-query

Creative Commons License
This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.
Content from: Stack Exchange

Important Link

  • About
  • Privacy Policy

IT Nursery

The Goal of ITNursery Engaging the world to foster innovation through aggregate information. Our Question Answer post, blog information, products and tools help developers and technologists in life and at work.

copyright © 2023 All Right Reserved | IT NurSery