How can I force a long string without any blank to be wrapped?
I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox? 16 Answers 16