WPF text Wrap vs WrapWithOverflow
What’s the “conceptual” difference between TextWrapping=”Wrap” and TextWrapping=”WrapWithOverflow” (e.g. for a TextBox)? In the MSDN page about the class TextBox there is nothing … Read more
word-wrap
How to word wrap text in HTML?
How can text like aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa which exceeds the width of a div (say 200px) be wrapped? I am open to any kind of … Read more
How to make a DIV not wrap?
I need to create a container DIV style that contains multiple other DIV’s. It is asked that these DIV’s wouldn’t wrap if the … Read more
How can I force a long string without any blank to be wrapped?
I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS … Read more
How to wrap text of HTML button with fixed width?
I just noticed that if you give an HTML button a fixed width, the text inside the button is never wrapped. I’ve tried … Read more
How should I use git diff for long lines?
I’m running git-diff on a file, but the change is at the end of a long line. If I use cursor keys to … Read more
vim command to restructure/force text to 80 columns
I know there are ways to automatically set the width of text in vim using set textwidth (like Vim 80 column layout concerns). … Read more
How can I wrap text in a label using WPF?
I have a TextBox and a Label. After clicking a button, I execute the following code: label1.Content = textbox1.Text; My question is, how … Read more
How can I toggle word wrap in Visual Studio?
Does Visual Studio .NET have a way to toggle word-wrap on and off? I am used to this feature in Eclipse which allows … Read more
How to stop text from taking up more than 1 line?
Is there a word-wrap or any other attribute that stops text from wrapping? I have a height, and overflow:hidden, and the text still … Read more