Home
Programming
- PHP
- C
- C++
DataBase
- MySQL
CMS
- WordPress

xul

How can I force a long string without any blank to be wrapped?

I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS … Read more

Tags CSS, HTML, string, word-wrap, xul

Important Tag

.net admin ajax android arrays bash c categories comments CSS custom-field custom-post-types custom-taxonomy customization database filters functions git hooks HTML images ios java javascript jQuery menus multisite MySQL node.js permalinks php plugin-development plugins posts python Shortcode sql string theme-development themes uploads users woocommerce-offtopic wp-admin wp-query

Recent Posts

INSTALL_FAILED_DUPLICATE_PERMISSION… C2D_MESSAGE
How to sort by meta value?
WPF text Wrap vs WrapWithOverflow
How to retrieve the list of all posts ever published via the feed?
how to use javascript Object.defineProperty

android c categories CSS custom-post-types custom-taxonomy customization database functions git HTML images java javascript jQuery multisite MySQL php plugin-development plugins posts python string theme-development wp-query

This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

Content from: Stack Exchange

Important Link

About
Privacy Policy

IT Nursery

The Goal of ITNursery Engaging the world to foster innovation through aggregate information. Our Question Answer post, blog information, products and tools help developers and technologists in life and at work.