xul Archives - IT Nursery

HTML, Programming

IT Nursery

How can I force a long string without any blank to be wrapped?

I have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would be the CSS ...

May 28, 2022
0 Comments

INSTALL_FAILED_DUPLICATE_PERMISSION… C2D_MESSAGE June 4, 2022

How to sort by meta value? June 4, 2022

WPF text Wrap vs WrapWithOverflow June 4, 2022

How to retrieve the list of all posts ever published via the feed? June 4, 2022

how to use javascript Object.defineProperty June 4, 2022

.htaccess (5)
.net (145)
.net-4.0 (2)
.net-core (2)
.net-core-configuration (1)
64-bit (1)
abi (1)
access-modifiers (1)
accessibility (1)
actionscript-3 (1)
active-directory (2)
adsense (1)
agile (1)
ajax (22)
algorithm (88)
amazon-ec2 (4)
amazon-web-services (39)
anaconda (2)
android (1,061)
android-dialogfragment (1)
android-emulator (3)
android-studio (35)
android-xml (1)
angular (139)
angular-cli (3)
angular6 (1)
angularjs (109)
angularjs-timeout (1)
animation (1)
ansible (7)
ant (1)
aop (1)
apache (19)
apache-flex (1)
apache-kafka (4)
apache-spark (6)
apache-zookeeper (1)
api (1)
apple-touch-icon (1)
architecture (13)
archive (1)
arrays (49)
artificial-intelligence (2)
asp-classic (1)
ASP.NET (77)
asp.net-core (3)
asp.net-mvc (60)
asp.net-mvc-2 (1)
asp.net-mvc-3 (6)
asp.net-mvc-4 (2)
asp.net-web-api (3)
assembly (6)
asynchronous (3)
atom-editor (1)
audio (2)
authentication (15)
autocomplete (2)
avd (1)
avmutableaudiomixinputparameters (1)
awk (4)
axios (2)
azure (3)
azure-web-roles (1)
backup (1)
base64 (2)
bash (358)
basic-authentication (1)
batch-file (23)
benchmarking (1)
big-o (1)
binary (2)
binary-tree (1)
bitbucket (1)
bluetooth (1)
bootstrap-4 (2)
bootstrapping (1)
bower (1)
branch (1)
branch-prediction (1)
Browser (7)
buffer (1)
build (3)
Business (3)
button (1)
C (219)
C# (1,430)
c#-4.0 (1)
C++ (676)
c++11 (2)
caching (3)
callback (1)
callstack (1)
captcha (1)
cassandra (1)
casting (1)
centos (2)
certificate (3)
cgi (1)
character-encoding (3)
chart.js (1)
checkbox (1)
class (4)
classpath (1)
client-server (1)
clojure (1)
cloud (1)
cmake (8)
cmd (1)
cocoa (8)
cocoa-touch (2)
cocoapods (1)
code-formatting (2)
coding-style (2)
collections (3)
colors (4)
comet (1)
command (1)
command-line (14)
comments (4)
common-lisp (1)
compare (1)
compilation (1)
compilationunit (1)
compiler-construction (4)
compiler-theory (1)
composer-php (2)
compression (3)
computer-science (2)
concurrency (4)
conditional-operator (1)
configuration (6)
confluence (1)
constants (1)
Consulting (1)
content-security-policy (1)
continuous-integration (2)
cookies (5)
copy (1)
cordova (4)
cors (2)
cpu (1)
cpu-architecture (1)
cqrs (1)
cron (2)
crontab (1)
cross-browser (1)
cryptography (1)
csrf (1)
CSS (382)
css-float (1)
css-selectors (2)
csv (5)
cuda (7)
curl (14)
custom-installation (1)
cx-oracle (1)
cygwin (2)
dapper (1)
dart (9)
data-oriented-design (1)
data-structures (4)
Database (63)
database-design (4)
dataframe (1)
datatable (1)
date (5)
datetime (9)
debian (2)
debugging (14)
default (1)
dependency-injection (4)
deployment (2)
design-patterns (26)
dictionary (10)
didselectrowatindexpath (1)
digital-signature (1)
directory (1)
django (62)
dll (2)
dns (4)
docker (160)
docker-compose (2)
dockerfile (1)
documentation (1)
domain-driven-design (3)
dos (1)
download (3)
duplicates (1)
dynamic-programming (2)
eclipse (66)
ecmascript-6 (1)
editor (5)
elasticsearch (10)
elisp (1)
elixir (1)
emacs (9)
email (8)
embedded-fonts (1)
ember.js (1)
emulation (1)
encoding (4)
encryption (4)
entity-framework (12)
entity-framework-4 (1)
entity-framework-core (1)
enums (2)
environment-variables (1)
erlang (2)
error-handling (1)
escaping (1)
eslint (2)
events (1)
excel (22)
excel-2007 (1)
exception (6)
exception-handling (1)
express (2)
facebook (9)
factory-pattern (1)
favicon (5)
ffmpeg (7)
fiddler (1)
file (20)
file-extension (1)
file-io (2)
filesystems (1)
Finance (1)
find (1)
firebase (7)
fish (1)
fixtures (1)
flash (2)
flexbox (1)
floating-point (4)
flutter (47)
font-size (1)
fonts (7)
for-loop (3)
foreach (1)
form-submit (1)
formatting (4)
forms (11)
frameworks (3)
function (10)
functional-programming (10)
g++ (1)
garbage-collection (1)
gcc (12)
gdata (1)
gdb (6)
gem (1)
generics (2)
geolocation (1)
geometry (2)
git (1,216)
git-bash (1)
git-branch (1)
git-commit (1)
git-merge (1)
github (57)
github-actions (1)
gitlab (4)
gnuplot (1)
go (47)
Google (6)
google-analytics (5)
google-api (3)
google-app-engine (2)
google-chrome (46)
google-chrome-devtools (1)
google-cloud-platform (2)
google-drive-api (1)
google-maps (5)
google-maps-api-3 (1)
google-play-services (1)
google-search (1)
google-sheets (5)
google-voice (1)
gradle (9)
graphics (2)
graphviz (1)
grep (7)
groovy (5)
gruntjs (1)
guid (2)
gulp (2)
gunicorn (1)
gzip (1)
hadoop (3)
handlebars.js (2)
hash (5)
haskell (28)
heroku (5)
hibernate (3)
homebrew (8)
hook (1)
HTML (22)
HTML (600)
html-lists (1)
html5-video (1)
http (75)
http-headers (7)
http-post (1)
https (3)
hungarian-notation (1)
icons (3)
ide (5)
if-statement (4)
iframe (2)
iis (5)
iis-7 (1)
iis-express (1)
image (16)
image-processing (4)
imagemagick (1)
imagenet (1)
import (3)
indentation (1)
indexing (1)
inheritance (3)
innovation (1)
installation (3)
integer (2)
intellij-idea (30)
intellisense (1)
internet-explorer (6)
internet-explorer-8 (1)
internet-explorer-9 (1)
ionic-framework (1)
ios (515)
ios7 (1)
ios8 (1)
ip (2)
iphone (54)
ipython (4)
iterm (2)
jackson (1)
jakarta-ee (1)
Java (3,354)
Java Script (3)
javafx (1)
javascript (2,578)
jenkins (11)
jestjs (5)
jinja2 (2)
jira (1)
jms (2)
jndi (1)
jpa (1)
jquery (279)
jquery-plugins (1)
jquery-ui (1)
jquery-validate (1)
jsf (6)
jshint (1)
json (80)
jsp (5)
junit (1)
jupyter-notebook (1)
jwt (1)
keyboard (2)
keyboard-shortcuts (4)
keystore (2)
keytool (1)
kotlin (15)
kubernetes (13)
lambda (1)
language-agnostic (36)
laravel (21)
latex (8)
layout (2)
licensing (1)
line-breaks (1)
linq (9)
linq-to-sql (3)
lint (1)
linux (338)
lisp (1)
list (6)
listview (1)
localhost (3)
localization (1)
log4j (1)
log4net (1)
logging (9)
logic (1)
loops (3)
lua (1)
lvm (1)
machine-learning (10)
macos (90)
macros (1)
magic-numbers (1)
makefile (21)
malloc (1)
mapreduce (1)
markdown (17)
math (11)
matlab (5)
matplotlib (3)
maven (24)
maven-2 (9)
memory (2)
memory-management (2)
mercurial (9)
merge (1)
methodology (1)
mime-types (2)
mocha.js (1)
model-view-controller (2)
momentjs (1)
mongodb (66)
mousewheel (1)
ms-word (1)
msbuild (2)
multipartform-data (1)
multithreading (19)
mvvm (1)
MySQL (378)
mysqldump (1)
naming-conventions (2)
networking (11)
neural-network (1)
newline (2)
nginx (14)
nhibernate (1)
node-webkit (1)
node.js (292)
nosql (3)
notepad++ (9)
npm (15)
nsstring (2)
nuget (5)
nullable (1)
numbers (1)
oauth (6)
oauth-2.0 (1)
objective-c (104)
odbc (1)
oop (28)
open-source (1)
opengl (3)
openssl (5)
operating-system (2)
operators (1)
optimization (4)
oracle (12)
orm (1)
out-of-memory (1)
outlook (1)
overflow (2)
package (1)
pandas (2)
parallel-processing (1)
parameters (3)
parsing (1)
path (5)
pdf (6)
perforce (1)
performance (25)
perl (13)
permissions (2)
PHP (584)
phpmyadmin (1)
pip (1)
pipenv (1)
playframework (1)
plot (1)
png (1)
podcast (1)
pointers (2)
port (1)
post (5)
postgresql (86)
powershell (51)
process (1)
Programming (21,581)
programming-languages (10)
properties (2)
protocol-buffers (2)
proxy (2)
pthreads (1)
pycharm (1)
Python (2,549)
python-3.x (1)
qt (2)
r (169)
rabbitmq (2)
random (4)
razor (1)
rdf (1)
react-native (7)
react-router-v4 (1)
reactjs (84)
realm (1)
recursion (2)
redirect (3)
redis (14)
reference (1)
regex (100)
replace (2)
request (1)
require (1)
requirejs (1)
requirements (1)
resources (2)
rest (34)
rsync (3)
ruby (182)
ruby-on-rails (181)
ruby-on-rails-3 (6)
ruby-on-rails-3.1 (1)
rubygems (1)
rust (13)
rxjs (2)
sass (3)
sbt (1)
scala (49)
scheduled-tasks (1)
scheme (1)
scope (1)
scripting (7)
scroll (2)
sdk (1)
search (7)
security (32)
sed (5)
select (1)
selenium (5)
selenium-webdriver (1)
seo (2)
serialization (2)
server (1)
server-side (1)
service (1)
servicestack (1)
servlets (1)
session (4)
sftp (1)
sh (2)
share (1)
shell (50)
signals (1)
soa (1)
sockets (6)
software-distribution (1)
solr (1)
sonarqube (1)
sorting (1)
special-characters (1)
spring (22)
spring-boot (1)
spring-mvc (1)
sql (446)
sql-server (157)
sql-server-2005 (2)
sql-server-2008 (5)
sql-server-2012 (1)
sqlite (21)
ssh (20)
ssh-keys (1)
ssl (8)
ssms (2)
stack-trace (1)
statistics (1)
string (61)
string-formatting (1)
struct (1)
subdomain (1)
sublimetext (5)
sublimetext2 (10)
sublimetext3 (1)
svg (7)
svn (42)
swift (74)
swift2 (1)
swiftui (1)
swing (3)
symfony (6)
synchronization (1)
syntax (6)
syntax-highlighting (1)
tabs (3)
task (1)
tcp (3)
telegram (1)
tensorflow (6)
terminal (6)
terminology (9)
testing (8)
text (6)
text-files (1)
text-processing (1)
tfs (4)
themes (3)
theory (2)
time (1)
time-complexity (1)
timezone (1)
tmux (5)
tomcat8 (1)
travis-ci (2)
tsql (6)
turtle-graphics (1)
Tutorial (18)
twig (1)
twitter (1)
twitter-bootstrap (21)
twitter-bootstrap-3 (2)
type-safety (1)
types (4)
typescript (97)
ubuntu (21)
ubuntu-16.04 (1)
uiimage (1)
uikit (1)
uitableview (1)
uiview (1)
uml (3)
Uncategorized (11)
underscore.js (1)
undo (1)
unicode (10)
unit-testing (26)
unix (40)
upload (1)
url (11)
urlencode (1)
urllib (1)
user-agent (1)
user-interface (6)
utf-8 (1)
uuid (1)
vagrant (4)
validation (9)
variables (3)
vb.net (3)
vb6 (1)
vba (4)
vectorization (1)
version-control (11)
versioning (1)
vi (1)
video (6)
view (1)
vim (116)
virtual-machine (1)
virtualbox (3)
visual-c++ (3)
visual-studio (89)
visual-studio-2008 (1)
visual-studio-2010 (14)
visual-studio-2012 (4)
visual-studio-2013 (5)
visual-studio-2015 (4)
visual-studio-code (72)
vue.js (15)
wamp (1)
warnings (1)
wcf (8)
wcf-binding (1)
Web Programming (11)
web-applications (2)
web-services (13)
webpack (5)
webserver (1)
webservice-client (1)
websocket (2)
webstorm (1)
wget (2)
winapi (1)
window (1)
windows (168)
windows-7 (3)
windows-8 (1)
windows-server-2003 (1)
windows-server-2008 (1)
windows-services (5)
windows-vista (1)
wireshark (1)
wix (1)
WordPress (22,083)
wpf (31)
x509 (1)
x86 (2)
xaml (2)
xargs (1)
xcode (62)
xcode4 (1)
xml (37)
xml-parsing (1)
xna (1)
xpath (3)
xslt (4)
yaml (5)
yarnpkg (2)
youtube (1)
zsh (2)